HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

Correspondence to:

BRIEF COMMUNICATIONS: R. H. Walker, A. Rasmussen, D. Rudnicki, S. E. Holmes, E. Alonso, T. Matsuura, T. Ashizawa, B. Davidoff-Feldman, and R. L. Margolis Huntington’s disease–like 2 can present as chorea-acanthocytosis Neurology 2003; 61: 1002-1004 [Abstract] [Full text] [PDF]

Correspondence: Submit a response to this article

Correspondence published:

Huntington’s disease–like 2 can present as chorea-acanthocytosis

Shinji Saiki, Koichiro Sakai, Misuzu Saiki, Genjiro Hirose   (4 March 2004)

Reply to Saiki et al

Ruth H. Walker, Russell L. Margolis   (4 March 2004)

Huntington’s disease–like 2 can present as chorea-acanthocytosis 4 March 2004
Shinji Saiki, Department of Neurology, Kanazawa Medical University 1-1 Daigaku, Uchinada, Ishikawa, Japan, Koichiro Sakai, Misuzu Saiki, Genjiro Hirose Send Correspondence to journal: Re: Huntington’s disease–like 2 can present as chorea-acanthocytosis saibon{at}kanazawa-med.ac.jp Shinji Saiki, et al.	We read with interest the article by Walker et al [1] who report a pedigree of autosomal dominant chorea-acanthocytosis (AD-ChAc) with an expansion of the CTG repeat within junctophilin-3 (JPH3) and without CHAC mutation. Of six patients in other pedigrees, one with Huntington's disease-like 2 (HDL2) with peripheral acanthocytosis is also presented. We previously reported a Japanese AD-ChAc pedigree having a frame-shift mutation in the CHAC gene. [2] Although the clinical phenotype of the kindred reported by Walker et al does not completely agree with ours, we undertook genetic analysis for the detection of a CTG/CAG expansion within JPH3 in our pedigree. Genomic DNA was extracted from lymphocytes using standard methods. The coding exon between exon 1 and exon 2B in the JPH3 gene was amplified by standard PCR with two primers, 5'GCACTGAGGAGTGGATATCGG3' and 5'CACCATTAGTTGAGGGAATCGAT3'. Both strands of the PCR products were directly sequenced. The allele's sizes of two affected individuals and one unaffected individual were 14 triplets, which is in the normal range from 6 to 27 repeats. [3] The authors claim that CTG trinucleotide repeat expansion mutation of the JPH3 causes AD-ChAc and suggest that HDL2 should be considered in the differential diagnosis of ChAc. However, all members of their pedigree showed severe dementia[1] which is an unusual symptom in ChAc, but usual in HD and HDL2. [4] Furthermore, they did not show orofacial dyskinesias, peripheral neuromuscular abnormalities, or seizures, which are also characteristics of ChAc. In our view, both their and our pedigrees show common clinical features, such as extrapyramidal symptoms and acanthocytosis, though they may suffer from different diseases. Although the genetic analysis for CTG/CAG trinucleotide expansion is effective in diagnosing AD-ChAc and HDL2, it is important to assess the clinical symptoms of patients with acanthocytosis, while keeping in mind their differences. Interestingly, the responsible genes (CHAC, JPH3, XK) in acanthocytosis encode membrane structure proteins, but several differences are noted among their clinical symptoms. [5] To understand the pathophysiology of these disorders, research into the common biological pathway of acanthocyte formation and the differences between involved and uninvolved organs is needed. Pathophysiology of acanthocytosis in domestic animals has not been studied except for abetalipoproteinemia. In addition to functional biological experiments, further investigation with genetically manipulated models harboring the mutations identified in each responsible gene are required to assess the functions of encoded proteins. References 1. Walker RH, Rasmussen A, Rudnicki D, et al. Huntington's disease-like 2 can present as chorea-acanthocytosis. Neurology 2003;61:1002-1004. 2. Saiki S, Sakai K, Kitagawa Y, Saiki M, Kataoka S, Hirose G. Mutation in the CHAC gene in a family of autosomal dominant chorea-acanthocytosis. Neurology 2003;61:1614-1616. 3. Holmes SE, O'Hearn E, Rosenblatt A, et al. A repeat expansion in the gene encoding junctophilin-3 is associated with Huntington disease-like 2. Nat Genet 2001;29:377-378. 4. Walker RH, Jankovic J, O'Hearn E, Margolis RL. Phenotypic features of Huntington's disease-like 2. Mov Disord 2003;18:1527-1530. 5. Rampoldi L, Danek A, Monaco AP. Clinical features and molecular bases of neuroacanthocytosis. J Mol Med 2002;80:475-491.
Reply to Saiki et al 4 March 2004
Ruth H. Walker, Bronx VA, Mount Sinai School of Medicine Dept of Neurology (127), Bronx VA, 130 W. Kingsbridge Road, Bronx NY 10468, Russell L. Margolis Send Correspondence to journal: Re: Reply to Saiki et al ruth.walker{at}mssm.edu Ruth H. Walker, et al.	We thank Saiki et al for their interest. [1] We are also interested in their report of the first family in which autosomal dominant chorea-acanthocytosis (ChAc) has been associated with mutation of chorein [2] but did not carry a mutation of junctophilin-3. [3] We agree that apart from the movement disorder, the clinical spectrum of HDL2 and HD differs from that of ChAc. [4] Although dementia is not a prominent early feature in ChAc, cognitive impairment and behavioral changes are widely reported and appear similar in quality, if not in severity, to those seen in HD and HDL2. [5,6] There may be significant overlap in clinical presentation, further compounded by the presence of acanthocytosis. It is important to perform both molecular and phenotypic characterization of this group of disorders where the pathophysiology is unclear. This is evident from Saiki et al’s report where an autosomal dominantly-inherited mutation causes a disorder which is apparently identical to the autosomal recessive form. In addition, HDL2 has only recently been described, and may vary in its manifestations. For example, it may vary if the number of trinucleotide repeats are in the borderline range or extremely large. HDL2 has currently only been reported in patients of African and not Japanese ancestry (Margolis et al, in preparation), but it possible that it may manifest differently in different ethnic populations like that of spinocerebellar ataxia type 4. [7,8] References 6. Danek A, Tierney M et al. Cognitive impairments in patients with chorea-acanthocytosis. Movement Disorders 2004; 16: S30-S31. 7. Flanigan K, Gardner K et al. Autosomal dominant spinocerebellar ataxia with sensory axonal neuropathy (SCA4): clinical description and genetic localization to chromosome 16q22.1. American Journal of Human Genetics 1996;59:392-399. 8. Nagaoka U, Takashima M et al. A gene on SCA4 locus causes dominantly inherited pure cerebellar ataxia. Neurology 2000;54:1971-1975.