We read with interest the article by Walker et al [1] who report a pedigree of autosomal dominant chorea-acanthocytosis (AD-ChAc)
with an expansion of the CTG repeat within junctophilin-3 (JPH3) and
without CHAC mutation. Of six patients in other pedigrees,
one with Huntington's disease-like 2 (HDL2) with peripheral acanthocytosis
is also presented.
We previously reported a Japanese AD-ChAc pedigree
having a frame-shift mutation in the CHAC gene. [2] Although the clinical
phenotype of the kindred reported by Walker et al does not completely agree with ours, we undertook genetic analysis for the
detection of a CTG/CAG expansion within JPH3 in our pedigree.
Genomic DNA was extracted from lymphocytes using standard methods. The
coding exon between exon 1 and exon 2B in the JPH3 gene was amplified by
standard PCR with two primers, 5'GCACTGAGGAGTGGATATCGG3' and
5'CACCATTAGTTGAGGGAATCGAT3'. Both strands of the PCR products were
directly sequenced. The allele's sizes of two affected individuals and one unaffected
individual were 14 triplets, which is in the normal range from 6 to
27 repeats. [3]
The authors claim that CTG trinucleotide repeat expansion mutation of the
JPH3 causes AD-ChAc and suggest that HDL2 should be considered in the
differential diagnosis of ChAc. However, all members of their pedigree
showed severe dementia[1] which is an unusual symptom in ChAc, but usual in HD and
HDL2. [4] Furthermore, they did not show orofacial dyskinesias, peripheral
neuromuscular abnormalities, or seizures, which are also characteristics
of ChAc.
In our view, both their and our pedigrees show common clinical
features, such as extrapyramidal symptoms and acanthocytosis, though they
may suffer from different diseases. Although the genetic analysis for
CTG/CAG trinucleotide expansion is effective in diagnosing AD-ChAc and
HDL2, it is important to assess the clinical
symptoms of patients with acanthocytosis, while keeping in mind their
differences.
Interestingly, the responsible genes (CHAC, JPH3, XK) in
acanthocytosis encode membrane structure proteins, but several differences
are noted among their clinical symptoms. [5] To understand the
pathophysiology of these disorders, research into the common biological
pathway of acanthocyte formation and the differences between involved and
uninvolved organs is needed. Pathophysiology of acanthocytosis in
domestic animals has not been studied except for abetalipoproteinemia. In addition to functional biological experiments, further
investigation with genetically manipulated models harboring the mutations
identified in each responsible gene are required to assess the functions
of encoded proteins.
References
1. Walker RH, Rasmussen A, Rudnicki D, et al. Huntington's disease-like 2
can present as chorea-acanthocytosis. Neurology 2003;61:1002-1004.
2. Saiki S, Sakai K, Kitagawa Y, Saiki M, Kataoka S, Hirose G. Mutation
in the CHAC gene in a family of autosomal dominant chorea-acanthocytosis.
Neurology 2003;61:1614-1616.
3. Holmes SE, O'Hearn E, Rosenblatt A, et al. A repeat expansion in the
gene encoding junctophilin-3 is associated with Huntington disease-like 2.
Nat Genet 2001;29:377-378.
4. Walker RH, Jankovic J, O'Hearn E, Margolis RL. Phenotypic features of
Huntington's disease-like 2. Mov Disord 2003;18:1527-1530.
5. Rampoldi L, Danek A, Monaco AP. Clinical features and molecular bases
of neuroacanthocytosis. J Mol Med 2002;80:475-491.